Send a DNA-o-gram
Your message will be encoded as DNA and you will be given the option to email the encoded message. The message will be accompanied by instructions on how to decode the message.
The actual DNA alphabet uses only 20 symbols. The DNA-o-gram generator lets you use the letters A-Z, a-z, numbers 0-9, <space>, and . .
Here's my DNA message (TShirts Available First Quarter 2007
:
CCAGAGGATGTCATGGAGTAAGCTCGTGGAATGCTTGGACTCGGCCTGCTTCTGATGTAGGATGTTGAGATGTCTTCGTCGATGGGGCTTGTACTCCTTGGAGTTATGAAAGCTCTTGTAGATCTCCGTGGAATGAATATCAAA
Translated:
This human encoded with 100 percent American DNA
Your message will be encoded as DNA and you will be given the option to email the encoded message. The message will be accompanied by instructions on how to decode the message.
The actual DNA alphabet uses only 20 symbols. The DNA-o-gram generator lets you use the letters A-Z, a-z, numbers 0-9, <space>, and . .
Here's my DNA message (TShirts Available First Quarter 2007
:CCAGAGGATGTCATGGAGTAAGCTCGTGGAATGCTTGGACTCGGCCTGCTTCTGATGTAGGATGTTGAGATGTCTTCGTCGATGGGGCTTGTACTCCTTGGAGTTATGAAAGCTCTTGTAGATCTCCGTGGAATGAATATCAAA
Translated:
This human encoded with 100 percent American DNA
